Debate and Discussion

Do you believe in evolution?
Tantz Aerine at 9:22AM, Nov. 28, 2007
(online)
posts: 1,618
joined: 10-11-2006
mlai
Metaphorical musings using fragments of science and applicaton of layman logic systems, will not explain evolution to you. A comprehensive course on biological sciences is necessary for that.

If you claim one can't understand evolution as science presents it to laymen, on what grounds do you defend it before you manage to really understand it and become able to answer to laymen's questions who have taken the time to study it, at least at the level of the afficionado? (This is not an attack to mlai, whose posts are usually really intelligent and fun to read- this is a general thought I wanted to share)

I have heard this often when science is used to offer a conundrum or comes up to a contesting of what is now considered ‘The Truth’ about everything and anything. If modern science can't explain it, then we say ‘it’s because you don't know ALL science, or you are a layman'.

However in all matters of education and knowledge, there exists one principle: If you can't explain it to your grandmother in very simple terms, you are missing something- or you at least have not understood it well yet.

Otherwise it sounds like the old (and bad) school teacher scrunching up his face and saying: ‘Don’t ask stupid questions, boy'.

So I would like either people to accept the scientific questions of another person without downputting it as ‘bastard science’ when they feel it most comfortable to suit their own views and ideas, just like they demand the same to be done when science speaks for their aforementioned views.

Otherwise it is just a double standard that seems to be making an appearance here- or a cop out. If you feel something is left out from the scientific approach by someone, go ahead research and present it. If you can't be bothered or you don't know where to find it or if you can't find it, I think it would be best if you just acknowledged the fact with a post like: ‘Good point. I’m sure there is an explanation for it, and I still don't believe you despite the evidence you present to me, but I will wait until the scientists prove me right before I put you down or dismiss you altogether.'

Wouldn't that be fairer?
 
last edited on July 14, 2011 4:07PM
mapaghimagsik at 9:37AM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
Not really. People really do need to think for themselves and all the schooling in the world wont' educate them.

Sure, there's the math teacher who annoyingly says “You don't get it, therefore you are a bad student” vs the idea that maybe they aren't presenting the idea well enough. At the same time, some people really aren't meant to get hard concepts – I probably won't be building missile guidance systems any time soon. At least, not out of my garage.

But, even though I can't build a guidance system, I can trust them to work with a degree of accuracy.

Taking on the role of teacher – especially to people who don't want to learn, but are cherry picking knowledge so they can scream “I win” is tedious, boring, and frankly not what most of us are paid for.

Science doesn't claim to solve everything, and it is complex because the world is complex.

However in all matters of education and knowledge, there exists one principle: If you can't explain it to your grandmother in very simple terms, you are missing something- or you at least have not understood it well yet.

I don't think that's a scientific principle – a source or two would be great. It might be true for a great many things, but this “all matters” stuff can be a bit tricky.
last edited on July 14, 2011 1:51PM
Tantz Aerine at 9:43AM, Nov. 28, 2007
(online)
posts: 1,618
joined: 10-11-2006
You are not actually disagreeing with me. In any case I feel you are right on almost all counts- except this one:

At the same time, some people really aren't meant to get hard concepts

This has been proven wrong. Even from the days of Skinner, upon whose principles and theories most of our technology and socio-educational systems are built, it was plainly (and scientifically proven) that all persons are geared and able to grasp hard concepts. However, during upbringing and development, this all-possible ability is curbed or culled to people who feel they can do certain things but not others.


Indeed, though, even this detail aside, if someone is not truly interested in knowledge but only in making a point or using it to other means, it is not worth it to put in the effort.

But that it still a question of choice ;)
 
last edited on July 14, 2011 4:07PM
Tantz Aerine at 9:46AM, Nov. 28, 2007
(online)
posts: 1,618
joined: 10-11-2006
Whoops, I didn't see your edit, mapaghimagsik . Sorry about that.

What sort of quote would you need? And what do you mean about the ‘all matter’ stuff? (sorry, I am a little tired today)
 
last edited on July 14, 2011 4:07PM
mapaghimagsik at 10:02AM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
Tantz Aerine
Whoops, I didn't see your edit, mapaghimagsik . Sorry about that.

What sort of quote would you need? And what do you mean about the ‘all matter’ stuff? (sorry, I am a little tired today)

What I mean is that there's some science its going to take me a while to get.

At a very simplistic level, I won't understand division and multiplication until I understand addition and subtraction (at least in the method I was taught) You can't explain Calculus to my grandmother – first of all, I doubt you speak Tagalog, and she doesn't understand Trig. At some point, you just have to say, “Look Po, when this function goes along infinitely it eventually will approach one, and you can finally say it is one.” But explaining the proof, much like explaining a proof in Geometry means understanding a few things.

Don't even begin to try and explain public key encryption to my grandmother – even if you know Tagalog.

And that's the “simple” stuff. Its why people can still go to college to study Math.

So while I agree that some science should be explainable in laymen's terms. There's some things the layman has to accept in order to move forward, such as the function moving toward 1 but never quite making it can be considered 1. I've seen lots of lay people get totally tripped up by this.

Again, still the simple stuff.

That's why I don't think your idea that all science should be explainable to a lay person works.
last edited on July 14, 2011 1:51PM
mapaghimagsik at 10:06AM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
While I'm at it, we're playing fast and loose with definitions here, which gets tricky unto itself.

What do you mean by a lay person getting it? To the level the lay person can apply Calculus to their every day doings? Most people don't even do that with algebra. Compound interest has people flummoxed, or they wouldn't be buying crap on credit.

To me, not being able to internalize a concept to put it to use means the person doesn't get it.

And again, what do we mean by lay person? What level of education? To someone with a good high school education, Algebra isn't so bad. Newspapers write to a fifth grade reading level. I didn't have Calculus in the fifth grade.
last edited on July 14, 2011 1:51PM
mapaghimagsik at 10:07AM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
arteestx
TnTComic
For example, the Laws dealing with motion, or thermodynamics, or conservation of matter and energy… They are very simple laws, and they are never incorrect. As I keep having to repeat, THAT'S WHY THEY'RE LAWS.

Actually your definition of laws is incorrect, and you have an example in your own list. Newton's Laws of Motion are not 100% correct. They are 99.99% correct in our standpoint of time and space, but Newton's laws completely break down when you approach speeds close to the speed of light. That's what Einstein proved with his laws of relativity that led to the field of quantum mechanics. Even scientific laws are falsifiable and occasionally prove to be inadequate or incomplete.

For the record, I think evolution is true.

Thanks for that clarification. And for the record 186,000 miles a second: Not just a good idea, its the law :D
last edited on July 14, 2011 1:51PM
Tantz Aerine at 10:13AM, Nov. 28, 2007
(online)
posts: 1,618
joined: 10-11-2006
mapaghimagsik
What I mean is that there's some science its going to take me a while to get.

more good explaining

That's why I don't think your idea that all science should be explainable to a lay person works.

Ah, ok. I see where you're coming from and I again agree with you.

Yes, it may take time to understand things. That is one of the basic principles of learning, absolutely. I was not referring to the time something might need to be explained, but to the fact that it can.

Your grandmother may not be able to understand functions if you throw the concept at her right off the cuff, but she will understand if you sit down and take the time to explain to her the principle in the way you very well described- starting from where she is and working her up to the point you need to get her to understand. I know this to be feasible because a. It's been proven in experiments and b. I have done it myself.

This is an article about kids learning binary logic- a concept far beyond their very base knowledge of arithmetic: http://www.garlikov.com/Soc_Meth.html

However, this brings us back to the previous point you made about which I agree completely: You need to take the time to sit down and explain, and many people don't have the time or the will to do it- or the skill.

This in turn brings us to my point, which was to simply either state that there is an explanation to the layman's questions but one that needs research and they should go find it. OR, if you have no answer for it, just acknowledge it could be a point and that science will eventually give out an answer to that as well.

Basic line is just to keep people from bashing each other as the trend seems to have been going for the past few months at least. Nothing constructive comes out of that, and if not for constructive purposes, then what?
 
last edited on July 14, 2011 4:07PM
mapaghimagsik at 10:23AM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
I completely agree with your statements – I might quibble about the fact that you *seem* to be saying that given enough time, anything can be explained.

I can't argue with that – except that people do not have infinite time, therefore understanding everything might – well you just might run out of time.

I would also say that you are assuming both listener and speaker are operating in good faith. Some explainers just don't understand something well enough to explain it, and then “punt”. Punting being where they switch subject and don't acknowledge they've just made a huge leap. Sadly, other explainers get defensive. One of my favorite punts is when you ask people about Noah's ark and ask them how the kangaroos got to Australia.

You've already addressed this condition though, but I think some topics lend itself to this rhetorical tricks than others. Politics is like this to the point that the facts are considered a nuisance.
last edited on July 14, 2011 1:51PM
horseboy at 11:08AM, Nov. 28, 2007
(offline)
posts: 139
joined: 8-27-2006
Tantz Aerine
If you claim one can't understand evolution as science presents it to laymen, on what grounds do you defend it before you manage to really understand it and become able to answer to laymen's questions who have taken the time to study it, at least at the level of the afficionado? (This is not an attack to mlai, whose posts are usually really intelligent and fun to read- this is a general thought I wanted to share)

I have heard this often when science is used to offer a conundrum or comes up to a contesting of what is now considered ‘The Truth’ about everything and anything. If modern science can't explain it, then we say ‘it’s because you don't know ALL science, or you are a layman'.
Yeah, this happens to me a lot. I enjoy sciences and try my best to keep up on things. But since I don't have the finances to be able to buy a piece of paper, let alone support myself while I buy one, whenever I try and ask a question, especially one like this the usual answer is either: “Well, you don't have a degree so you're not allowed to question,” or they'll try and hand wave it away. I, by nature, and uncomfortable with things I'm told simply to accept and not question.
So I would like either people to accept the scientific questions of another person without downputting it as ‘bastard science’ when they feel it most comfortable to suit their own views and ideas, just like they demand the same to be done when science speaks for their aforementioned views.

Otherwise it is just a double standard that seems to be making an appearance here- or a cop out. If you feel something is left out from the scientific approach by someone, go ahead research and present it. If you can't be bothered or you don't know where to find it or if you can't find it, I think it would be best if you just acknowledged the fact with a post like: ‘Good point. I’m sure there is an explanation for it, and I still don't believe you despite the evidence you present to me, but I will wait until the scientists prove me right before I put you down or dismiss you altogether.'

Wouldn't that be fairer?
I can understand why people are confused. This is one of those times where I'm not being a bastard here. This is an honest question from me about something I really don't understand. From what I've been able to find this was one of the major stumbling blocks for Darwin himself, in that he said it would require a chimera to be able to bridge certain gaps, but no chimera has been/was ever found.

Could I add a few more coma splices?
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
Kilre at 12:04PM, Nov. 28, 2007
(online)
posts: 221
joined: 9-25-2007
horseboy
Okay, everybody knows and accepts adaptation. That's easily observed and tested. That's not the question. The question is how does a DNA strand suddenly have a new base pair and how does the theory of evolution take into account the theory of genetics at that point. Because in order for an organism to go from having 10 base pairs to 11 base pairs is one Hell of a mutation. The problem roots itself in the three principles in genetics of:
1) When two members of the same species reproduce, they create a third member of the species. (This is why dogs don't have kittens)
2) When two members of different species reproduce they create nothing. (This is why there are no centaurs in TJ or West Virginia)
3) When you change the number of base pairs you change the species.

How does evolution over come this? It seems it would have to violate the first and third rule in order to have a “mutation” come about that have an extra base pair. It would either then have to violate the second rule or would have to have a staggering number of births within a concentrated area for them to be able to reproduce in. So basically, all the people in, say, NYC would have to suddenly be born with 24 base pairs. The statistical odds of this happening would make the likelyhood of Mary being born an XY female with a crude uterus releasing a self fertilized egg actually probable.

An this statistical odd and violation of genetics has had to have happened at least what, 15 times? (tobbacco has at least 25 IIRC) How is that possible? I just don't understand how that's possible.

The addition of base pairs changes the proteins that are made. DNA is mainly a blueprint for the production of proteins, proteins that keep your body functioning and moving as it should. It does this through the use of codons, which is the sequence of nucleotides in the base pairs.

If it is for the betterment of the organism, then nothing bad will happen. If the additional base pairs fucks up the amino acid sequence in the proteins, then the mutation will likely cause the organism to die.

Below is what a–pulled out of the ass–nucleotide sting would look like. Every 3 nucleotides is marked off into a codon.

AAG|TAC|GTT|AGT|AAG|CGC|ATG|GCT|AGC…and on until the end.

There is a specific start and stop combination, but I forget exactly what they are. Either way, messing with this order, either by changing a base pair, or adding a base pair (which happens around every 1/10,000 time a DNA strand replicates–for when cells divide) is mutation. As above, mutations that don't affect you adversely go largely unnoticed. You have probably accrued thousands of mutations in your body alone simply from this process.

The reason you aren't dead now from saturation of screw-ups in your DNA is because the codons (the sequence of 3 nucleotides, as detailed above) have many ways to code for a single protein. I forget, again, the combinations, but AAG and TAC and AGT could, in potentia, all code for the same protein to be added (this is probably not true, but again I forget which codons code for which amino acids).

Changing the number of base pairs could, over a long period of time, change the species. However, considering the amount of mutations happening almost every day, it's safe to say that there are a few strands of DNA within your body that have a few more base pairs than normal.

For further reading, and where I got my impromptu reacquaintance with codons and DNA from, check this:

TheBlackCat over at Bad Astronomy and Universe Today Forums
Well, there are a number of mechanisms. It is true that adding a base pair in a part of an unique gene that is coding for a protein will almost always render that protein inoperable. However, this is only a case if both those conditions are met. There are a number of situation in which that might not be the case.

First, the simplest is when there are multiple copies of the same gene. There are mechanisms which I am not very familiar with by which individual complete genes may be duplicated in a life-form's genome (I should be learning them soon). These include various proteins that duplicate segments as well as crossing over, a mechanism by which genes can shift from one chromosome to another. Obviously, once a gene has been duplicated one copy of the gene can mutate all it wants without affecting the cell's ability to make the protein, since the other copy of the gene can still produce sufficient amounts of the protein to supply the cell's need. This, as I understand it, is thought to be the mechanism by which the clotting cascade evolved. Parts duplicated, then mutated to catalyze the triggering of the original. Then these parts duplicates and mutated to catalyze the formation of the new molecule. Repeat several times and you have a cascade where each stage catalyzes the triggering of the next stage.

Another mechanism involves introns and exons. In eukaryote (i.e. not bacteria) DNA, the actual DNA code is usually not the final code that is read to make the protein. The DNA is converted into RNA, then parts of the RNA are removed and the remaining bits recombined to form a new RNA sequence. This shorter sequence is then read to make proteins. However, which sections of a given RNA are deleted and which are kept is not always the same. Sometime some sections of the RNA are kept, and other times other sections are kept. This way a single RNA, and thus a single gene, can code for a wide variety of proteins. Not all possible versions of the final RNA are useful, some have formed that do not code for anything and thus changes to those sections do not adversely affect the organism (unless they begin coding for something toxic) This means parts of a gene can grow, shrink, and change freely without altering the function of other sections. If these mutations suddenly make something useful, then the organism has a new, useful protein. I am not exactly clear on whether all combinations are synthesized or only specific one, or if it varies depending on the gene. Some sections may have to undergo some change to be recognized as useful sections.

Finally, for most eukaryotic organisms there are two copies of most genes. That means one gene can be mutated while still allowing the other to function normally. If this change on its own does not impede the function of the organism it can be what is called a “recessive” allele, an allele that only come into affect if two copies of the gene are present. This way you can get mutant genes without adversely affecting the organism, assuming the organism only has one copy of the gene. If the organism has two copies, they cannot produce the normal protein and can die as a result. Most human genetic disorders are of this sort. Because they only affect a small proportion of the creatures carrying them, they can persist in the population for long periods of time and can mutate freely during that time, possibly forming something useful. Some of these genes are lethal if an organism has two but can be helpful if an organism only has one. For instance, malaria cannot survive in people who have one sickle-cell anemia genes, but the people are not significantly affected by it. Likewise, people who have a single cystic fibrosis gene appear to be resistant to the bubonic plague and typhoid fever, even though they are not significantly harmed by the gene. However, these genes are lethal if someone has two copies.

I am not sure based on your post if you know this or not, but there is something to keep in mind with DNA. Every possible combination of 3 DNA bases has a corresponding codon that goes with it. The DNA is what is called “degenerate”, there are usually several different DNA triplets that code for a certain amino acid. So no matter what triplet you put together, you will always find either an amino acid or stop codon that goes with it. The problem is that adding or deleting base pairs (called frame shift mutations) will alter every codon after them (assuming they are not done in a multiple of 3). This is because it the starting and stopping point of each codon changes.

Say you have a sequence like this:

AAGTACGTTAGTAAGCGCATGGCTAGC…

Starting from the first base, the triplets will be as follows

AAG|TAC|GTT|AGT|AAG|CGC|ATG|GCT|AGC…

Say, however, you add a new base after the 5th one:

AAGTAACGTTAGTAAGCGCATGGCTAGC…

The triplets will now be as follows:

AAG|TAA|CGT|TAG|TAA|GCG|CAT|GGC|TAG|C…

As you can see, every codon after the addition has been completely changed. This means it is most likely every amino acid has also been changed. Frame shift mutations are very serious, and it is unlikely they could be viable in a coding segment of DNA unless they occurred near the very end of the gene. This particular change actually causes the fourth codon to change from coding for a serine amino acid residue to coding for a “stop” codon, which would cause the ribosome to stop synthesizing the protein completely and thus terminate the protein after only 3 amino acids have been added instead of the dozens, hundreds, or even thousands normally found in proteins. This is a common problem with frame shift mutations. (that stop codon was not intential, BTW, I just types in a random series of bases and that is what happened)

Hope this helps.

It's also EXTREMELY important to note that changes within the body's cells DO NOT affect the gametes (i.e., sex cells). Eggs and sperm do their own things in complete autonomy from the main body. Gametes are separated from the main body sometime during development in the womb (I think) and so whatever mutations you have at birth your gametes will carry. By that same token, whatever mutations you accrue over the course of your life WILL NOT alter, in any way, the DNA carried in your gametes.

Horseboy, I think you also have “base pairs” confused with “chromosomes”, which are two completely different beasts. From Wikipedia, of all places, “The haploid human genome (23 chromosomes) is estimated to be about 3 billion base pairs long and to contain 20,000-25,000 distinct genes.” Chromosomes hold the DNA strands, which in turn are themselves the long chains of base pairs of nucleotides. So yes, if there are more than the normal number of chromosomes, bad things happen. You may not even be born–alive and working, that is–if you wind up with more or less than the normal number of chromosomes. However, like stated above, DNA mish-mashing is quite normal.

EDIT: added some more Wiki pages.
http://en.wikipedia.org/wiki/Base_pair
http://www.bautforum.com/general-science/33185-question-about-evolution-addition-base-pairs.html
http://en.wikipedia.org/wiki/Chromosome
http://en.wikipedia.org/wiki/Codon
http://en.wikipedia.org/wiki/Genome
last edited on July 14, 2011 1:15PM
mlai at 1:48PM, Nov. 28, 2007
(online)
posts: 3,035
joined: 12-28-2006
*Long discussion between Tantz and Mapa.*

The above dialogue renders any additional reply from me (regarding my previous post) redundant.

*Very long explanation by Kilre.*

And this is why, Horseboy, ppl just “wave you off” instead of “take the time to explain to you.” You want ppl to commit the time and effort to teach/type something like this for someone over the internet? We had to pay college tuition, and sit in class all day, and pay 100s of dollars for textbooks, and READ said textbooks, for the opportunity to learn this stuff, but we're supposed to teach it over a webcomics forum?

Ppl don't expect to be taught calculus or programming by someone over a recreational forum, nor would they act like know-it-alls and argue with the math/comp-sci professor, but when it comes to evolution, OH I KNOW THE FACTS~ OH I UNDERSTAND BECAUSE I READ SUCH AND SUCH IN THIS I.D. WEBSITE~

Why is biology treated like such a bastard science? (Yes I'm bitter.)

Edit: Hey, I'm flattered you ‘friended’ me. Altho most of us certainly aren't looking to be friended when we come to the Debates forum, heheh.

Usually it's because one's blood pressure is dropping, and needed a treatment before losing consciousness.

FIGHT current chapter: Filling In The Gaps
FIGHT_2 current chapter: Light Years of Gold
last edited on July 14, 2011 2:06PM
horseboy at 2:26PM, Nov. 28, 2007
(offline)
posts: 139
joined: 8-27-2006
mlai
And this is why, Horseboy, ppl just “wave you off” instead of “take the time to explain to you.” You want ppl to commit the time and effort to teach/type something like this for someone over the internet? We had to pay college tuition, and sit in class all day, and pay 100s of dollars for textbooks, and READ said textbooks, for the opportunity to learn this stuff, but we're supposed to teach it over a webcomics forum?

Ppl don't expect to be taught calculus or programming by someone over a recreational forum, nor would they act like know-it-alls and argue with the math/comp-sci professor, but when it comes to evolution, OH I KNOW THE FACTS~ OH I UNDERSTAND BECAUSE I READ SUCH AND SUCH IN THIS I.D. WEBSITE~
Well, the hand waving on this one tends to be more of a “Well, it happens over millions of years.” If someone would actually just give me a link to a book they've read on like Amazon that actually answers this question (most I've read are very vague about this particular problem) I'd be happier.
Why is biology treated like such a bastard science? (Yes I'm bitter.)

Edit: Hey, I'm flattered you ‘friended’ me. Altho most of us certainly aren't looking to be friended when we come to the Debates forum, heheh.

Usually it's because one's blood pressure is dropping, and needed a treatment before losing consciousness.
Sure, I figured out how that worked, as I've said before just because I don't agree with people doesn't mean I don't like them. ;)
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
Kilre at 2:30PM, Nov. 28, 2007
(online)
posts: 221
joined: 9-25-2007
horseboy
Well, the hand waving on this one tends to be more of a “Well, it happens over millions of years.” If someone would actually just give me a link to a book they've read on like Amazon that actually answers this question (most I've read are very vague about this particular problem) I'd be happier.


I should hope it's not the same question I just answered.
last edited on July 14, 2011 1:15PM
horseboy at 2:43PM, Nov. 28, 2007
(offline)
posts: 139
joined: 8-27-2006
Kilre
horseboy
Well, the hand waving on this one tends to be more of a “Well, it happens over millions of years.” If someone would actually just give me a link to a book they've read on like Amazon that actually answers this question (most I've read are very vague about this particular problem) I'd be happier.


I should hope it's not the same question I just answered.
Well, I'm still reading it, while flipping through the forums and inking and looking for a job. Let me digest it for a bit, I usually do my best thinking around 3am. We'll see if I still have questions later.
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
Kilre at 2:46PM, Nov. 28, 2007
(online)
posts: 221
joined: 9-25-2007
horseboy
Well, I'm still reading it, while flipping through the forums and inking and looking for a job. Let me digest it for a bit, I usually do my best thinking around 3am. We'll see if I still have questions later.

Jeebus, 3 am?! I start killing people who get between me and the bed at that time.

If you have further questions, I'll be here…lurking, I suppose.
last edited on July 14, 2011 1:15PM
Tantz Aerine at 3:08PM, Nov. 28, 2007
(online)
posts: 1,618
joined: 10-11-2006
mapaghimagsik
I completely agree with your statements – I might quibble about the fact that you *seem* to be saying that given enough time, anything can be explained.

I can't argue with that – except that people do not have infinite time, therefore understanding everything might – well you just might run out of time.

That is very true. :( It just means that everyone should prioritize on what to explain/learn/understand. But then again I guess that we do have enough time to understand enough of the world so we can live in it without blowing it or ourselves up- provided of course, we are interested in that :/

I would also say that you are assuming both listener and speaker are operating in good faith.

Can't deny that either. I'm ever the optimist even when I am downright cynical. Maybe because when I explain or ask or listen or argue, I always do it in good faith, I expect the other party to be doing the same. And of course, everything I say holds for people who are interested in constructive interaction.

Some explainers just don't understand something well enough to explain it, and then “punt”. Punting being where they switch subject and don't acknowledge they've just made a huge leap. Sadly, other explainers get defensive. One of my favorite punts is when you ask people about Noah's ark and ask them how the kangaroos got to Australia.

You've already addressed this condition though, but I think some topics lend itself to this rhetorical tricks than others. Politics is like this to the point that the facts are considered a nuisance.

Also very true. :(


To Kilre: That was a really good snippet! I enjoyed it and made me want to go review my neurobiology again. Good job!!

Horseboy: I understand your feelings. I'd tune out those who dismiss you without listening to you, but if I were you I would also acquire the books needed (you seem to be doing that) and make sure I present everything in a way that cannot be dismissed. It is not the paper, it's the knowledge. Just watch Lorenzo's Oil to see true ability in humans.

Mlai: Asking for someone to teach for free would truly be a little too much. But I think anyone can take the time to drop a link if they have one. You have been doing that often when it is needed, from what I've seen ;)

You guys, I think this thread actually now has a positive atmosphere! *gasp!* I think I heard a crack of thunder.
 
last edited on July 14, 2011 4:07PM
mapaghimagsik at 4:08PM, Nov. 28, 2007
(offline)
posts: 711
joined: 9-8-2006
That cracking sound might be more ice forming in Hell.
last edited on July 14, 2011 1:51PM
horseboy at 5:24PM, Nov. 28, 2007
(offline)
posts: 139
joined: 8-27-2006
Tantz Aerine
You guys, I think this thread actually now has a positive atmosphere! *gasp!* I think I heard a crack of thunder.

mapaghimagsik
That cracking sound might be more ice forming in Hell.

“And the demons did make sign of their displeasure of their orders by pressing their tongues betwixt their teeth and the sergeant did respond my sounding his buttock liken unto that of a trumpet.”

I don't know why, just thought I'd paraphrase Dante there.
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
arteestx at 9:39PM, Nov. 28, 2007
(online)
posts: 285
joined: 6-1-2007
horseboy
Okay, everybody knows and accepts adaptation. That's easily observed and tested. That's not the question. The question is how does a DNA strand suddenly have a new base pair and how does the theory of evolution take into account the theory of genetics at that point. Because in order for an organism to go from having 10 base pairs to 11 base pairs is one Hell of a mutation. The problem roots itself in the three principles in genetics of:
1) When two members of the same species reproduce, they create a third member of the species. (This is why dogs don't have kittens)
2) When two members of different species reproduce they create nothing. (This is why there are no centaurs in TJ or West Virginia)
3) When you change the number of base pairs you change the species.

How does evolution over come this? It seems it would have to violate the first and third rule in order to have a “mutation” come about that have an extra base pair. It would either then have to violate the second rule or would have to have a staggering number of births within a concentrated area for them to be able to reproduce in. So basically, all the people in, say, NYC would have to suddenly be born with 24 base pairs. The statistical odds of this happening would make the likelyhood of Mary being born an XY female with a crude uterus releasing a self fertilized egg actually probable.

An this statistical odd and violation of genetics has had to have happened at least what, 15 times? (tobbacco has at least 25 IIRC) How is that possible? I just don't understand how that's possible.
First of all, I need to point out that there is considerable debate about what the definition of a species is. Is it the ability to procreate? Is it the number of chromosomes? I won't go into details, but just know that there is a LOT of gray area in terms of the definition of “species.”

That said, I'm still not sure I understand the question. Changing the number of base pairs doesn't create a new species. A human that has some extra base pairs put int their DNA sequence doesn't stop being a human. But to answer your question, changing the number of base pairs happens all the time. Genetic mutations that add or delete base pairs are collectively known as indels. An example of this kind of mutation is cystic fibrosis, which is deletion of some base pairs. Huntington's Disease is an example where base pairs are inserted.

If you're referring to the number of chromosomes, which would impact the development of a new species, polyploidy (the condition of having extra sets of chromosomes) also happens. Polyploidy occurs during a failure in meiosis (the process that creates gametes, reproductive cells like sperm and eggs). In a nutshell, meiosis is supposed to create 1/2 the number of chromosomes of the parent, so that the combination of gametes creates offspring with a complete set of chromosomes (1/2N + 1/2N = 1N). In polyploidy, meiosis goes awry and creates a full set of chromosomes so that the offspring now has twice the chromosomes of the parent (1N + 1N = 2N) and becomes a new species. Considering that some plants and animals reproduce asexually, you can see how new species could be created in this manner instantaneously. As you can imagine, this is rarer in sexually reproducing organisms, but there have also been observed polyploid species of sexual animals, frogs and fish I believe.

And these are just some examples, and are by no means are a complete description of all the different methods that the number of base pairs and chromosomes can change. I hope this helps.

Xolta is not intended for anyone under 18 years old.
last edited on July 14, 2011 11:02AM
mlai at 2:14AM, Nov. 29, 2007
(online)
posts: 3,035
joined: 12-28-2006
Someone
the sergeant did respond my sounding his buttock liken unto that of a trumpet.
LOL, awesome my Middle English grammar was correct, even though at the time I wrote pg 13, I was completely making it up.

Edit: Well, no, not ‘completely.’ But I was winging it compared to what I know now…

Yup, the term ‘species’ is completely arbitrary categorization. As more is learned about genetics, this term becomes more fuzzy.

FIGHT current chapter: Filling In The Gaps
FIGHT_2 current chapter: Light Years of Gold
last edited on July 14, 2011 2:06PM
horseboy at 11:03AM, Nov. 29, 2007
(offline)
posts: 139
joined: 8-27-2006
mlai
Why is biology treated like such a bastard science? (Yes I'm bitter.)
You know, I'm pretty sure this was supposed to have been rhetorical, but for some reason it caught my imagination last night. I think it's because it's the only “hard” science without a branch of physics involved. Nothing will make someone's eyes glaze over faster than a nice, Greek formula. Then turn and go “Okay, I'll believe you.” Few want to argue math. Biology doesn't have that. It's much like Sociology and Psych in that it's all ideas and vocabulary. As such, it's automatically considered intellectual Open Source and that every one expects to be able to comment on it. Or at least that's what I came up with between arguing about spiked chains and Kill Puppies of Satan.

Yeah, I am familiar with the whole “The DNA breaks down and builds back while you live” thought. As this is generally seen as why we get feeble as we get old. Our bodies are recreating imperfect copies of prior cells. But meiosis tends to protect against that, as Kilre pointed out.

OH, BTW, thanks for that new avenue, I'm currently reading this guy's papers about what happens when you splice stuff where into DNA, not sure if it's going to answer anything yet, but it looks promising.
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
mlai at 11:53AM, Nov. 29, 2007
(online)
posts: 3,035
joined: 12-28-2006
Biology gives the illusion that it's intellectual open source, but it's not akin to soft science. Dolly didn't pop out of the womb from ideas. And I didn't assist on the paper “Effect of dimerization on signal transduction and biological function of oncogenic ros, insulin, and insulin-like growth factor I receptors” by having scintillating discourse with colleagues all day.

I'm reluctant to call psych a soft science…

FIGHT current chapter: Filling In The Gaps
FIGHT_2 current chapter: Light Years of Gold
last edited on July 14, 2011 2:06PM
Dirk Zephyrs at 12:17PM, Nov. 29, 2007
(offline)
posts: 921
joined: 11-9-2007
In response to the title.

Yes.

Thanks, guys, y'all are entirely tl;dr.
Pink Floyd
Breathe, breathe in the air.
Don't be afraid to care.
last edited on July 14, 2011 12:11PM
horseboy at 12:22PM, Nov. 29, 2007
(offline)
posts: 139
joined: 8-27-2006
mlai
Biology gives the illusion that it's intellectual open source, but it's not akin to soft science. Dolly didn't pop out of the womb from ideas. And I didn't assist on the paper “Effect of dimerization on signal transduction and biological function of oncogenic ros, insulin, and insulin-like growth factor I receptors” by having scintillating discourse with colleagues all day.
Illusion, I knew I forgot a word. Guess that's why we have peer review. ;)
I'm reluctant to call psych a soft science…
I know they're slowly switching in a lot of places from BA's to BS's. Thereby, muscling into “hard” status. Wasn't sure how far they've gotten lately.
There is no such word as “alot”. “A lot” is two words.
Voltaire
Never seek for happiness, it will merely allude the seeker. Never strive for knowledge, it is beyond man's scope. Never think, for in though lies all the ills of mankind. The wise man, like the rat, the crocodile, the fly, merely fulfills his natural function.
last edited on July 14, 2011 12:50PM
Tantz Aerine at 7:26AM, Nov. 30, 2007
(online)
posts: 1,618
joined: 10-11-2006
Psychology is not a soft science. It's not just the type of degree, BA or BSc, it's the way you go about it. It is also the results you get.

If you can make a little boy be afraid of the colour white and fur on purpose and after specific procedures, you are dealing with equations.

Some even in Greek formulas ;)
 
last edited on July 14, 2011 4:07PM
Loud_G at 8:31AM, Nov. 30, 2007
(online)
posts: 389
joined: 8-13-2007
I'm not opposed to evolution. I think that it is the best explanation of natural phenomenon that we have CURRENTLY. It is based on a very partial knowledge of the history of world species, but even for that limited nature it is very elegant. This doesn't mean that I believe or disbelieve it as a whole. Adaptation and small scale evolution makes sense to me. Evolution from single cell organism into the whole breadth and width of spectrum of animal life….well…lets just say I'm hesitant. I know all about the biological facts of chromosomes and the subtle changes. I just find it hard to justify the huge leaps.

By the way….evolutionary theory did not make Dolly possible. Genetic science and understanding made that possible. It is not the same thing. Genetics works without accepting large scale evolution.

But again. I'm not really on either side of the fence. It could be the definitive, true life explanation of how stuff works, or it could be that a better method is discovered later. It works for our purposes today. The only issue I have with evolution is the constant use of it in debates on theism vs. atheism. It has no bearing there, but atheists have deified Darwin and seem to think Darwinian Evolution is concrete proof against Deity. Whatever, they have the right to believe that, but it really has no place in that debate other than it annoys the heck out of Christians. :D

So, I continue on the fence, awaiting further proof.
Find out what George is up to:

 
 
Go! Visit George or he may have to eat you!*
*Disclaimer: George may or may not eat violators depending on hunger level and scarcity of better tasting prey.
last edited on July 14, 2011 1:46PM
mlai at 9:05AM, Nov. 30, 2007
(online)
posts: 3,035
joined: 12-28-2006
@ Loud_G:
If you're hesitant over macro evolution simply because you don't feel there's adequate data, then fine. There is enough, but you're entitled.

But if you're hesitant because you think an Abrahmic God created the world in 7 days… or something… then don't hide that bias; just come out with it. It makes life easier for others.

That is, if that's what you mean.

Genetics and evolution are interconnected. Without understanding in that fundamental framework, you would be working with large gaps in your mind. You'd have trouble as an innovator and thinker. But you could function very well as a grunt in the lab all day, sure.

Also you'd be hitting obstacles all day long trying to innovate in Animal Behavior research, etc.

FIGHT current chapter: Filling In The Gaps
FIGHT_2 current chapter: Light Years of Gold
last edited on July 14, 2011 2:06PM
TnTComic at 10:02AM, Nov. 30, 2007
(offline)
posts: 681
joined: 6-25-2007
Loud_G
I know all about the biological facts of chromosomes and the subtle changes. I just find it hard to justify the huge leaps.

If you know about it, how can you say there were “huge leaps”? One part of that statement does not jive with the other.
last edited on July 14, 2011 4:31PM
Loud_G at 10:44AM, Nov. 30, 2007
(online)
posts: 389
joined: 8-13-2007
mlai
@ Loud_G:
If you're hesitant over macro evolution simply because you don't feel there's adequate data, then fine. There is enough, but you're entitled.

But if you're hesitant because you think an Abrahmic God created the world in 7 days… or something… then don't hide that bias; just come out with it. It makes life easier for others.

That is, if that's what you mean.

No, not really. I'm not anti evolution for religious reasons. Evolution is not something that negates religion or God.

I have no idea HOW God created the world and everything in it. For all I know he had a bunch of test tubes and grew everything. I don't know. I do believe that God works with science or rather within the laws that govern the universe because He created those laws. If evolution was the vehicle that He used to give a variety of life to the earth, then that is what he used. I have no qualms on that. And no I don't believe the earth was created in 7 solar days, but that “day” in genesis was an unspecified length of time in which to accomplish a task.

So, no. I'm not a fence sitter because of my belief in God. Science will never disprove God because he exist. I believe in science and I believe in God and I believe that eventually through science we will be able to learn more about God. (Even though there IS a quicker less ‘scientific’ way to learn about Him which provides irrefutable answers.)

But that is all superfluous to the debate at hand. Just background to my position.

I have read about it. I have studied all the sciences and engineering. I am a GeoScience person. So I have a back ground and understanding of scientific principles and theory and discovery. I just have not seen enough conclusive evidence to back evolution 100% of the way. I have seen what some people call conclusive, but which really has holes all through it.

Which is fine. Science is not truth, but the search for truth. It is not requisite to be right about everything NOW. Science is merely the path for gaining a better understanding of the universe. Evolution works well enough for behavioral research and such, but who knows, we might find something better.

Til then, I will not say Evolution is the definite answer. Nor will I say, AHHHH ITS EVIIIIIIIILLLLLLL!!!!!!!11111!!!.

It is the best we have to work with for the time being. :)
Find out what George is up to:

 
 
Go! Visit George or he may have to eat you!*
*Disclaimer: George may or may not eat violators depending on hunger level and scarcity of better tasting prey.
last edited on July 14, 2011 1:46PM

Forgot Password
©2011 WOWIO, Inc. All Rights Reserved